ID: 1105981963_1105981964

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1105981963 1105981964
Species Human (GRCh38) Human (GRCh38)
Location 13:25526677-25526699 13:25526693-25526715
Sequence CCTACAGCATGGTGCTGCTAAGC GCTAAGCAGACACTGCAATTTGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 17, 3: 45, 4: 161} {0: 1, 1: 0, 2: 1, 3: 7, 4: 108}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!