ID: 1105983040_1105983044

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1105983040 1105983044
Species Human (GRCh38) Human (GRCh38)
Location 13:25538294-25538316 13:25538327-25538349
Sequence CCTGGCTATTTGGGGTTTTTTTC GGGCACTGAGTCAAGAGCAGTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 5, 3: 61, 4: 630} {0: 1, 1: 0, 2: 1, 3: 28, 4: 287}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!