ID: 1106000931_1106000936

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1106000931 1106000936
Species Human (GRCh38) Human (GRCh38)
Location 13:25722395-25722417 13:25722409-25722431
Sequence CCATTCCCTATAGGGTGCTGCCT GTGCTGCCTGCATTTTGCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 213} {0: 1, 1: 0, 2: 2, 3: 25, 4: 252}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!