ID: 1106017127_1106017128

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1106017127 1106017128
Species Human (GRCh38) Human (GRCh38)
Location 13:25880094-25880116 13:25880107-25880129
Sequence CCATGGGGTACTGTTTTGGGCAC TTTTGGGCACAGTGACAGCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 89} {0: 1, 1: 0, 2: 1, 3: 11, 4: 191}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!