ID: 1106031462_1106031474

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1106031462 1106031474
Species Human (GRCh38) Human (GRCh38)
Location 13:26009366-26009388 13:26009417-26009439
Sequence CCTGGACACCCTCTCCATGCTTC GCATCTGCGCACGTGTGGTGTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 42, 4: 384} {0: 1, 1: 0, 2: 1, 3: 15, 4: 86}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!