|
Left Crispr |
Right Crispr |
| Crispr ID |
1106042054 |
1106042063 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
13:26103047-26103069
|
13:26103094-26103116
|
| Sequence |
CCTGGCTCATCTCACTGGGACTG |
GAGGGCAAGCAGAAGCAGGATGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 72, 1: 556, 2: 975, 3: 1210, 4: 932} |
{0: 4, 1: 88, 2: 316, 3: 677, 4: 1453} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|