ID: 1106050116_1106050119

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1106050116 1106050119
Species Human (GRCh38) Human (GRCh38)
Location 13:26181608-26181630 13:26181642-26181664
Sequence CCAAGCTATACCATTGGTAGGTA CTTGGACCCCTGCCCACAGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 74, 4: 1715} {0: 1, 1: 0, 2: 1, 3: 24, 4: 243}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!