ID: 1106055388_1106055395

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1106055388 1106055395
Species Human (GRCh38) Human (GRCh38)
Location 13:26232188-26232210 13:26232224-26232246
Sequence CCTGCTTCCTGAAACTCCTCTGG AGTTGGGACTACCTGGAAACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 21, 4: 280} {0: 1, 1: 0, 2: 0, 3: 5, 4: 122}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!