ID: 1106074846_1106074854

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1106074846 1106074854
Species Human (GRCh38) Human (GRCh38)
Location 13:26449091-26449113 13:26449120-26449142
Sequence CCAGGCAGGCCCTGGATCTTGAA CTGTGGACCCATCTGGGGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 291} {0: 1, 1: 1, 2: 10, 3: 109, 4: 1364}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!