ID: 1106081094_1106081109

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1106081094 1106081109
Species Human (GRCh38) Human (GRCh38)
Location 13:26500864-26500886 13:26500907-26500929
Sequence CCCTTAGCCTGGAGAGAAGGAGC ACCTGGATAGCGGCTGGGTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 16, 4: 180} {0: 1, 1: 0, 2: 1, 3: 27, 4: 301}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!