|
Left Crispr |
Right Crispr |
Crispr ID |
1106094614 |
1106094616 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
13:26632189-26632211
|
13:26632209-26632231
|
Sequence |
CCAGAACTTCGAATACTATGTTG |
TTGAATAAGCATGGTGAGAGAGG |
Strand |
- |
+ |
Off-target summary |
{0: 12, 1: 2075, 2: 11111, 3: 4346, 4: 1714} |
{0: 1, 1: 32, 2: 741, 3: 11832, 4: 7667} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|