ID: 1106095398_1106095408

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1106095398 1106095408
Species Human (GRCh38) Human (GRCh38)
Location 13:26638981-26639003 13:26639020-26639042
Sequence CCCACTGTCCTCCTATTTTCCAC CTGAGGCCCTTACCAGGTGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 299} {0: 1, 1: 0, 2: 9, 3: 51, 4: 291}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!