|
Left Crispr |
Right Crispr |
| Crispr ID |
1106112782 |
1106112789 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
13:26791751-26791773
|
13:26791778-26791800
|
| Sequence |
CCAACTGTTGTGGGAGGGACCAG |
AGATCATTGAATTATGGGGGTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 17, 2: 301, 3: 2536, 4: 5909} |
{0: 2, 1: 93, 2: 1272, 3: 3528, 4: 5841} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|