ID: 1106112782_1106112789

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1106112782 1106112789
Species Human (GRCh38) Human (GRCh38)
Location 13:26791751-26791773 13:26791778-26791800
Sequence CCAACTGTTGTGGGAGGGACCAG AGATCATTGAATTATGGGGGTGG
Strand - +
Off-target summary {0: 1, 1: 17, 2: 301, 3: 2536, 4: 5909} {0: 2, 1: 93, 2: 1272, 3: 3528, 4: 5841}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!