ID: 1106114017_1106114026

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1106114017 1106114026
Species Human (GRCh38) Human (GRCh38)
Location 13:26801608-26801630 13:26801652-26801674
Sequence CCAGCAGATTCCATGAGCAGCGT GCTTACAGCAGTGGGCTCAGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 97} {0: 1, 1: 0, 2: 0, 3: 15, 4: 187}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!