ID: 1106129976_1106129980

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1106129976 1106129980
Species Human (GRCh38) Human (GRCh38)
Location 13:26932092-26932114 13:26932112-26932134
Sequence CCTTCAATCAAGGGAGCTCCTGT TGTTACAGCCATGGGTCCTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 96} {0: 1, 1: 0, 2: 0, 3: 12, 4: 160}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!