ID: 1106134164_1106134176

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1106134164 1106134176
Species Human (GRCh38) Human (GRCh38)
Location 13:26961908-26961930 13:26961954-26961976
Sequence CCATGCTGCCTCTGTGCACCTTC GCCACCCTCCCACCCTCTGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 37, 4: 436} {0: 1, 1: 0, 2: 7, 3: 45, 4: 316}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!