ID: 1106138282_1106138293

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1106138282 1106138293
Species Human (GRCh38) Human (GRCh38)
Location 13:26990693-26990715 13:26990722-26990744
Sequence CCCACCACACCCTCACACGCCCG CACCTTCTGTGCAGGGCCATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 38, 4: 387} {0: 1, 1: 0, 2: 1, 3: 17, 4: 194}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!