|
Left Crispr |
Right Crispr |
| Crispr ID |
1106152807 |
1106152815 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
13:27122382-27122404
|
13:27122430-27122452
|
| Sequence |
CCCCAGCCATGTGGAACTGTAAG |
GGTCTTGGGTACATCTTTATTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1791, 1: 5734, 2: 7090, 3: 7321, 4: 5798} |
{0: 1, 1: 1, 2: 10, 3: 101, 4: 263} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|