ID: 1106157214_1106157222

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1106157214 1106157222
Species Human (GRCh38) Human (GRCh38)
Location 13:27170937-27170959 13:27170954-27170976
Sequence CCACCTTCACACACGCCCCTTTC CCTTTCCCCCAGCGCGGGGTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 28, 4: 319} {0: 1, 1: 0, 2: 1, 3: 10, 4: 123}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!