|
Left Crispr |
Right Crispr |
| Crispr ID |
1106174725 |
1106174729 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
13:27320522-27320544
|
13:27320541-27320563
|
| Sequence |
CCTCTCTATGTGGCCTGGGCTTC |
CTTCCTCCCAACATGGTGGCTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 5, 1: 14, 2: 67, 3: 156, 4: 504} |
{0: 3, 1: 22, 2: 88, 3: 169, 4: 555} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|