ID: 1106189165_1106189169

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1106189165 1106189169
Species Human (GRCh38) Human (GRCh38)
Location 13:27435890-27435912 13:27435919-27435941
Sequence CCTCCTAAAAAAGGGAAACAGCC TAATTTAAAATCAGAGGCTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 207} {0: 1, 1: 0, 2: 5, 3: 39, 4: 386}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!