ID: 1106194399_1106194408

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1106194399 1106194408
Species Human (GRCh38) Human (GRCh38)
Location 13:27480954-27480976 13:27480972-27480994
Sequence CCCACCCACACCTCCACCCTCAA CTCAACTGTGAAGATAACTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 10, 3: 187, 4: 1214} {0: 1, 1: 0, 2: 0, 3: 10, 4: 208}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!