ID: 1106211794_1106211796

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1106211794 1106211796
Species Human (GRCh38) Human (GRCh38)
Location 13:27655632-27655654 13:27655653-27655675
Sequence CCCTTGATAAAGCTGGTGACTAC ACCAGATCTCTCCATTATAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 76} {0: 1, 1: 2, 2: 15, 3: 39, 4: 196}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!