ID: 1106211845_1106211851

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1106211845 1106211851
Species Human (GRCh38) Human (GRCh38)
Location 13:27656491-27656513 13:27656505-27656527
Sequence CCTGCTCTCTTGGAATTTATAAT ATTTATAATCTAATGGGGGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 15, 3: 100, 4: 651} {0: 1, 1: 0, 2: 0, 3: 30, 4: 241}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!