ID: 1106214263_1106214266

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1106214263 1106214266
Species Human (GRCh38) Human (GRCh38)
Location 13:27680425-27680447 13:27680443-27680465
Sequence CCAGCAGAAGAAAGCTGTAAATG AAATGAGACCAGAGGGATGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 21, 4: 283} {0: 1, 1: 1, 2: 2, 3: 51, 4: 448}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!