ID: 1106216887_1106216892

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1106216887 1106216892
Species Human (GRCh38) Human (GRCh38)
Location 13:27709933-27709955 13:27709981-27710003
Sequence CCCAGCTCCTTGTTTGCTTAATG CTCAAACATAATCTTCAGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 199} {0: 1, 1: 0, 2: 1, 3: 8, 4: 189}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!