|
Left Crispr |
Right Crispr |
| Crispr ID |
1106219391 |
1106219397 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
13:27733153-27733175
|
13:27733204-27733226
|
| Sequence |
CCAAAGTGCTAGGATTATAGGCA |
TTAAATAGGACAAGTCTAGAAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1111, 1: 20803, 2: 131421, 3: 253929, 4: 238116} |
{0: 1, 1: 0, 2: 0, 3: 10, 4: 172} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|