ID: 1106223966_1106223973

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1106223966 1106223973
Species Human (GRCh38) Human (GRCh38)
Location 13:27771328-27771350 13:27771378-27771400
Sequence CCGATCTTGGTGCCACCTGGTTG CTCAGGCCCAGCCACATTCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 106} {0: 1, 1: 0, 2: 2, 3: 33, 4: 260}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!