ID: 1106226300_1106226312

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1106226300 1106226312
Species Human (GRCh38) Human (GRCh38)
Location 13:27789692-27789714 13:27789744-27789766
Sequence CCACCCCGCCCCGCTCTGGGGGA CGGCTAAAGCAAGCCCTGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 38, 4: 362} {0: 1, 1: 0, 2: 0, 3: 6, 4: 108}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!