ID: 1106226520_1106226525

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1106226520 1106226525
Species Human (GRCh38) Human (GRCh38)
Location 13:27790668-27790690 13:27790688-27790710
Sequence CCAGCCTGCCTCTGCCCAGCGGA GGAAAGCCCCTCTCCCCGCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 45, 4: 391} {0: 1, 1: 0, 2: 1, 3: 19, 4: 251}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!