ID: 1106229687_1106229693

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1106229687 1106229693
Species Human (GRCh38) Human (GRCh38)
Location 13:27812252-27812274 13:27812300-27812322
Sequence CCTGCACTAGGGTGGTAGCTGTG CCGAAGTCACTACTTGCTGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 173} {0: 1, 1: 0, 2: 0, 3: 3, 4: 50}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!