ID: 1106231863_1106231869

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1106231863 1106231869
Species Human (GRCh38) Human (GRCh38)
Location 13:27826775-27826797 13:27826798-27826820
Sequence CCTGTGCGTGGCCGCCATAGCTA GGAAGCCTTCCCAAGTCGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 25} {0: 1, 1: 0, 2: 1, 3: 22, 4: 236}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!