ID: 1106251242_1106251246

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1106251242 1106251246
Species Human (GRCh38) Human (GRCh38)
Location 13:27983169-27983191 13:27983188-27983210
Sequence CCTTGATCTTTCTGTGCCCCAAA CAAAAATGTCGAGTTCATCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 277} {0: 1, 1: 0, 2: 0, 3: 9, 4: 122}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!