ID: 1106253510_1106253528

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1106253510 1106253528
Species Human (GRCh38) Human (GRCh38)
Location 13:28001808-28001830 13:28001859-28001881
Sequence CCCTGCTGGGGACCCCACCCGGA CAGTCCCTGGCTTGAAGGTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 28, 4: 189} {0: 1, 1: 43, 2: 132, 3: 295, 4: 710}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!