ID: 1106269417_1106269431

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1106269417 1106269431
Species Human (GRCh38) Human (GRCh38)
Location 13:28138915-28138937 13:28138952-28138974
Sequence CCCCCTGGCTCTGGCTGGTGCAC CCGCCGGGAGCCGTCGCGGGCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 42, 4: 359} {0: 1, 1: 0, 2: 0, 3: 11, 4: 118}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!