ID: 1106283843_1106283847

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1106283843 1106283847
Species Human (GRCh38) Human (GRCh38)
Location 13:28302033-28302055 13:28302052-28302074
Sequence CCAACTGTGTTGGTGAATTGGTT GGTTTGGTTGGTATAGAGACGGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 24, 4: 172} {0: 2, 1: 0, 2: 2, 3: 20, 4: 341}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!