ID: 1106283888_1106283899

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1106283888 1106283899
Species Human (GRCh38) Human (GRCh38)
Location 13:28302491-28302513 13:28302537-28302559
Sequence CCAGAATCCAGAAAATGTCCCCT CTGGGCCCTCAAATGTAGAAGGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 2, 3: 18, 4: 196} {0: 2, 1: 0, 2: 1, 3: 7, 4: 138}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!