ID: 1106286651_1106286657

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1106286651 1106286657
Species Human (GRCh38) Human (GRCh38)
Location 13:28323839-28323861 13:28323855-28323877
Sequence CCAATTTCTCAGGTTTCTTTGGG CTTTGGGGAAGGAGGGAACATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 36, 4: 317} {0: 1, 1: 0, 2: 5, 3: 59, 4: 616}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!