ID: 1106293715_1106293722

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1106293715 1106293722
Species Human (GRCh38) Human (GRCh38)
Location 13:28390690-28390712 13:28390736-28390758
Sequence CCTGGCCTCATTTCCTATTTTTA GGCAAGTGACACTGGCAAGTGGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 52, 3: 462, 4: 2812} {0: 1, 1: 0, 2: 1, 3: 11, 4: 162}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!