ID: 1106294765_1106294768

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1106294765 1106294768
Species Human (GRCh38) Human (GRCh38)
Location 13:28401799-28401821 13:28401830-28401852
Sequence CCTGTCATGGATTTGTCTCATAC TTTCTCAAGGTACACTCAGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 112} {0: 1, 1: 0, 2: 0, 3: 14, 4: 173}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!