ID: 1106300777_1106300788

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1106300777 1106300788
Species Human (GRCh38) Human (GRCh38)
Location 13:28462803-28462825 13:28462854-28462876
Sequence CCCCACCACGACCAAAGTGAACT GCACAGAGCAGGCCCCTATCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 127} {0: 1, 1: 0, 2: 0, 3: 14, 4: 179}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!