ID: 1106314403_1106314416

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1106314403 1106314416
Species Human (GRCh38) Human (GRCh38)
Location 13:28580428-28580450 13:28580459-28580481
Sequence CCGGAGTTCCCCAGGGACTCCTA ATGAATTGGTTTGGGGTGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 157} {0: 1, 1: 0, 2: 3, 3: 32, 4: 378}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!