ID: 1106331825_1106331829

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1106331825 1106331829
Species Human (GRCh38) Human (GRCh38)
Location 13:28746413-28746435 13:28746445-28746467
Sequence CCCGGCTCCTATTCAAGATGGAG TTCACATGCCTCTGACACAATGG
Strand - +
Off-target summary No data {0: 1, 1: 4, 2: 14, 3: 55, 4: 197}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!