ID: 1106350213_1106350225

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1106350213 1106350225
Species Human (GRCh38) Human (GRCh38)
Location 13:28922631-28922653 13:28922681-28922703
Sequence CCCCCAGTCATTGCGCTCTCCCT AGGCGGCCACTGTCAAGAGATGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 27, 3: 64, 4: 277} {0: 1, 1: 0, 2: 0, 3: 14, 4: 111}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!