ID: 1106356708_1106356711

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1106356708 1106356711
Species Human (GRCh38) Human (GRCh38)
Location 13:28990194-28990216 13:28990228-28990250
Sequence CCTGGGACTTCGGAAGGAGCTGT GACTCTTTTCTATGCAATTAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 143} {0: 1, 1: 0, 2: 0, 3: 10, 4: 157}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!