ID: 1106380747_1106380749

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1106380747 1106380749
Species Human (GRCh38) Human (GRCh38)
Location 13:29236491-29236513 13:29236506-29236528
Sequence CCTAGACAGAAGAGGTTGAAATA TTGAAATAGCTTGTGGTGAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 310} {0: 1, 1: 0, 2: 3, 3: 20, 4: 202}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!