ID: 1106385569_1106385575

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1106385569 1106385575
Species Human (GRCh38) Human (GRCh38)
Location 13:29282234-29282256 13:29282272-29282294
Sequence CCCAGAGAGAAGTGCTGCCTCTG GCCATGCTCCTGCTGGCTCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 276} {0: 1, 1: 1, 2: 1, 3: 41, 4: 316}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!