ID: 1106388069_1106388077

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1106388069 1106388077
Species Human (GRCh38) Human (GRCh38)
Location 13:29307531-29307553 13:29307570-29307592
Sequence CCTGCCAAATATGATGACATCAA GTGTCAGAGGGCCCCCTCAAGGG
Strand - +
Off-target summary {0: 11, 1: 12, 2: 12, 3: 18, 4: 178} {0: 2, 1: 1, 2: 6, 3: 15, 4: 87}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!