ID: 1106409499_1106409506

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1106409499 1106409506
Species Human (GRCh38) Human (GRCh38)
Location 13:29501384-29501406 13:29501429-29501451
Sequence CCACCTTGAGAGAAATGAGTGAA GTCCTCCTGCAGCACTGGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 228} {0: 1, 1: 1, 2: 5, 3: 35, 4: 269}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!