ID: 1106409508_1106409513

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1106409508 1106409513
Species Human (GRCh38) Human (GRCh38)
Location 13:29501431-29501453 13:29501447-29501469
Sequence CCTCCTGCAGCACTGGGAGGGGA GAGGGGAAGGGGTTTATTTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 39, 4: 519} {0: 1, 1: 0, 2: 0, 3: 42, 4: 374}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!